Microsatellite Repeats Finder - Bioinformatics Tools (www.yourlabdata.com)
This tool finds microsatellites in DNA sequences. Microsatellites are copies ofsimple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.
Author: Your Lab Data
Source: View XML
Copy & paste this code into your site:
Related module: Restriction Digest of DNA - Bioinformati...
